MirGeneDB

Gene name

Hme-Mir-276

Family name MIR-276 (all species)
Species Longwing butterfly (Heliconius melpomene)
MiRBase ID hme-mir-276
Paralogues
Orthologues Aae-Mir-276-P1  Aae-Mir-276-P2  Bge-Mir-276  Dan-Mir-276-P1  Dan-Mir-276-P2  Dme-Mir-276-P1  Dme-Mir-276-P2  Dmo-Mir-276-P1  Dmo-Mir-276-P2  Dpu-Mir-276  Isc-Mir-276  Tca-Mir-276  Tca-Mir-276-as 
Node of Origin (locus) Panarthropoda
Node of Origin (family) Panarthropoda
Genome context
(Hmel_1)
HE671577: 38337-38393 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GAAAAGAAGAAAACACUGGUGAUUGCCACUAGCGAGGUAUAGAGUUCCUACGUAAUAUAGAACUGUAGGAACUUCAUACCGUGCUCUUGGGUUUGCCAAUGGUCUACAAUUCUAAUA
Get precursor sequence
Structure
        10           20        30        40        50        
GAAAAGAAGAAAACACU---| UG UUG   CU    A     AG          UAAUA 
                    GG  A   CCA  AGCG GGUAU  AGUUCCUACG     \
                    CC  U   GGU  UCGU CCAUA  UCAAGGAUGU     U
AUAAUCUUAACAUCUGGUAA^ GU UG-   UC    G     CU          CAAGA 
     110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Ad Ad Fe Fe Fe Fe Ma Ma
Star sequence

Hme-Mir-276_5p*

MirBase accessionMIMAT0024954
Sequence
0- AGCGAGGUAUAGAGUUCCUACG -22
Get sequence
Mature sequence

Hme-Mir-276_3p

MirBase accessionNone
Sequence
35- UAGGAACUUCAUACCGUGCUCU -57
Get sequence
Seed sequenceAGGAACU