MirGeneDB

Gene name

Dmo-Mir-276-P1

Family name MIR-276 (all species)
Species Fruit fly (Drosophila mojavensis)
MiRBase ID dmo-mir-276a
Paralogues Dmo-Mir-276-P2 
Orthologues Aae-Mir-276-P1  Bge-Mir-276  Dan-Mir-276-P1  Dme-Mir-276-P1  Dpu-Mir-276  Hme-Mir-276  Isc-Mir-276  Tca-Mir-276 
Node of Origin (locus) Diptera
Node of Origin (family) Panarthropoda
Genome context
(Dmoj_caf1)
scaffold_6680: 20621851-20621911 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCCAAAGUAUGCUACCUGGUUUUUGCCAUCAGCGAGGUAUAGAGUUCCUACGUUCAAUUUAAAUACUCGUAGGAACUUCAUACCGUGCUCUUGGAAGACCAAAACACAACUCAAACAAAAA
Get precursor sequence
Structure
        10            20        30        40        50          
UCCAAAGUAUGCUACCU----|     UG   UC    A     AG          UUCAAUU 
                     GGUUUU  CCA  AGCG GGUAU  AGUUCCUACG       \
                     CCAGAA  GGU  UCGU CCAUA  UCAAGGAUGC       U
AAAAACAAACUCAACACAAAA^     --   UC    G     CU          UCAUAAA 
 .       110       100          90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Em Fe Ma Ma
Mature sequence

Dmo-Mir-276-P1_5p

MirBase accessionNone
Sequence
0- AGCGAGGUAUAGAGUUCCUACG -22
Get sequence
Seed sequenceGCGAGGU
Co-mature sequence

Dmo-Mir-276-P1_3p

MirBase accessionMIMAT0008654
Sequence
39- UAGGAACUUCAUACCGUGCUCU -61
Get sequence
Seed sequenceAGGAACU