MirGeneDB

Gene name

Tca-Mir-276

Family name MIR-276 (all species)
MiRBase ID tca-mir-276
Paralogues
Orthologues Dme-Mir-276-P1  Dme-Mir-276-P2  Dpu-Mir-276  Isc-Mir-276 
Node of Origin (gene) Panarthropoda
Node of Origin (family) Panarthropoda
Genome context
(Tcas5.2)
LG3: 12483938-12483995 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
GCGGAACGGCGCUCUUUUUGGUAGACCACUAGCGAGGUAUAGAGUUCCUACGUGAUUUUUCGGCUGUAGGAACUUCAUACCGUGCUCUUGGAUUUACCGACCAUCAACGCACACACCA
Get precursor sequence
Structure
        10         20         30        40        50        
GCGGAACGGCGCUCUUU-        -|  CU    A     AG          UGAUU 
                  UUGGUAGA CCA  AGCG GGUAU  AGUUCCUACG     U
                  AGCCAUUU GGU  UCGU CCAUA  UCAAGGAUGU     U
ACCACACACGCAACUACC        A^  UC    G     CU          CGGCU 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
CommentThe reverse complement is also expressed at relatively significant levels.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ea Em Em Em Em Em Oo
Star sequence

Tca-Mir-276_5p*

MirBase accessionMIMAT0008380
Sequence
0- AGCGAGGUAUAGAGUUCCUACG -22
Get sequence
Mature sequence

Tca-Mir-276_3p

MirBase accessionMIMAT0008381
Sequence
36- UAGGAACUUCAUACCGUGCUCU -58
Get sequence
Seed sequenceAGGAACU