MirGeneDB

Gene name

Aae-Mir-276-P2

Family name MIR-276 (all species)
Species Yellow fever mosquito (Aedes aegypti)
MiRBase ID aae-mir-276-2
Paralogues Aae-Mir-276-P1 
Orthologues Bge-Mir-276  Dan-Mir-276-P2  Dme-Mir-276-P2  Dmo-Mir-276-P2  Dpu-Mir-276  Hme-Mir-276  Isc-Mir-276  Tca-Mir-276 
Node of Origin (locus) Diptera
Node of Origin (family) Panarthropoda
Genome context
(Aaeg_L3)
supercont1.5: 2769509-2769572 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UAGAUUUCCAGUGUCUCGAGUUAAUCCGUCAGCGAGGUAUAGAGUUCCUAUGCGUUCGGAUAAAAUAUUCCAUAGGAACUUCAUACCGUGCUCUUGGAUUGCUUGGAAGUCAUCGAGAGGGUAA
Get precursor sequence
Structure
        10           20        30        40        50        60 
UAGAUUUCCAGUGUCUC---|   U      UC    A     AG          CGUUCGGA 
                    GAGU AAUCCG  AGCG GGUAU  AGUUCCUAUG        U
                    UUCG UUAGGU  UCGU CCAUA  UCAAGGAUAC        A
AAUGGGAGAGCUACUGAAGG^   -      UC    G     CU          CUUAUAAA 
  120       110        100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Fe Fe Fe Fe To To To
Star sequence

Aae-Mir-276-P2_5p*

MirBase accessionNone
Sequence
0- AGCGAGGUAUAGAGUUCCUAUG -22
Get sequence
Mature sequence

Aae-Mir-276-P2_3p

MirBase accessionMIMAT0014223
Sequence
42- UAGGAACUUCAUACCGUGCUCU -64
Get sequence
Seed sequenceAGGAACU