MirGeneDB

Gene name

Dmo-Mir-276-P2

Family name MIR-276 (all species)
MiRBase ID dmo-mir-276b
Paralogues Dmo-Mir-276-P1 
Orthologues Aae-Mir-276-P2  Bge-Mir-276  Dan-Mir-276-P2  Dme-Mir-276-P2  Dpu-Mir-276  Hme-Mir-276  Isc-Mir-276 
Node of Origin (gene) Diptera
Node of Origin (family) Panarthropoda
Genome context
(Dmoj_caf1)
scaffold_6680: 20678234-20678295 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUGUAAAGAUAACGAAGUCUAUAUACCAUCAGCGAGGUAUAGAGUUCCUACGUGCAAAUUGCAAUAGUCGUAGGAACUUAAUACCGUGCUCUUGGAGGGCUGUCGACCAACAAAACGAAUAA
Get precursor sequence
Structure
        10        20          30        40        50        60
UUGUAAAGAUAACGAAGUCUAUAUA--|  UC    A     A           UGCAAAU 
                           CCA  AGCG GGUAU GAGUUCCUACG       U
                           GGU  UCGU CCAUA UUCAAGGAUGC       G
AAUAAGCAAAACAACCAGCUGUCGGGA^  UC    G     A           UGAUAAC 
120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Em Fe Ma Ma
Mature sequence

Dmo-Mir-276-P2_5p

MirBase accessionNone
Sequence
0- AGCGAGGUAUAGAGUUCCUACG -22
Get sequence
Seed sequenceGCGAGGU
Star sequence

Dmo-Mir-276-P2_3p*

MirBase accessionMIMAT0008631
Sequence
40- UAGGAACUUAAUACCGUGCUCU -62
Get sequence