MirGeneDB

Gene name

Dme-Mir-276-P2

Family name MIR-276 (all species)
Species Fruit fly (Drosophila melanogaster)
MiRBase ID dme-mir-276b
Paralogues Dme-Mir-276-P1 
Orthologues Aae-Mir-276-P2  Bge-Mir-276  Dan-Mir-276-P2  Dmo-Mir-276-P2  Dpu-Mir-276  Hme-Mir-276  Isc-Mir-276  Tca-Mir-276 
Node of Origin (locus) Diptera
Node of Origin (family) Panarthropoda
Genome context
(dm6)
chr3L: 10319808-10319867 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AACGAAAAAAACCGAAGUCUUUUUACCAUCAGCGAGGUAUAGAGUUCCUACGUUCCUAUAUUCAGUCGUAGGAACUUAAUACCGUGCUCUUGGAGGACUGUCGACCAGCAUAUAGUUAAA
Get precursor sequence
Structure
        10        20          30        40        50         
AACGAAAAAAACCGAAGUCUUUUUA--|  UC    A     A           UUCCUA 
                           CCA  AGCG GGUAU GAGUUCCUACG      U
                           GGU  UCGU CCAUA UUCAAGGAUGC      A
AAAUUGAUAUACGACCAGCUGUCAGGA^  UC    G     A           UGACUU 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo He L3 Fe Fe La Wh
Mature sequence

Dme-Mir-276-P2_5p

MirBase accessionMIMAT0020815
Sequence
0- AGCGAGGUAUAGAGUUCCUACG -22
Get sequence
Seed sequenceGCGAGGU
Co-mature sequence

Dme-Mir-276-P2_3p

MirBase accessionMIMAT0000354
Sequence
38- UAGGAACUUAAUACCGUGCUCU -60
Get sequence
Seed sequenceAGGAACU
Validated targets microrna.org: MIMAT0000354
TargetScanFly: dme-miR-276b