MirGeneDB

Gene name

Isc-Mir-276

Family name MIR-276 (all species)
Species tick (Ixodes sp)
MiRBase ID isc-mir-276
Paralogues
Orthologues Aae-Mir-276-P1  Aae-Mir-276-P2  Bge-Mir-276  Dan-Mir-276-P1  Dan-Mir-276-P2  Dme-Mir-276-P1  Dme-Mir-276-P2  Dmo-Mir-276-P1  Dmo-Mir-276-P2  Dpu-Mir-276  Hme-Mir-276  Tca-Mir-276  Tca-Mir-276-as 
Node of Origin (locus) Panarthropoda
Node of Origin (family) Panarthropoda
Genome context
(IscaWI)
DS848078: 34728-34788 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
CGUAUCGCUAGGGGAAGUCGCGCUAUCGCGAGCGGGGUACGGAGGUCUUACUGUGAGCGUCAAGCCAGCUAGGAACUUCAUACCAUGCUCGCUAUGGCAGACGACACGUUCUUCGGACAAG
Get precursor sequence
Structure
        10           20        30        40        50          
CGUAUCGCUAGGGGAAG---| GC     C       G    C    G     -  GUGAGC 
                    UC  GCUAU GCGAGCG GGUA GGAG UCUUA CU      G
                    AG  CGGUA CGCUCGU CCAU CUUC AGGAU GA      U
GAACAGGCUUCUUGCACAGC^ A-     U       A    A    A     C  CCGAAC 
 .       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Al Mi Mi Mi Sa Sa Sa Sa To
Star sequence

Isc-Mir-276_5p*

MirBase accessionNone
Sequence
0- AGCGGGGUACGGAGGUCUUACU -22
Get sequence
Mature sequence

Isc-Mir-276_3p

MirBase accessionMIMAT0018919
Sequence
39- UAGGAACUUCAUACCAUGCUCG -61
Get sequence
Seed sequenceAGGAACU