MirGeneDB

Gene name

Efe-Mir-67-P2

Family name MIR-67 (all species)
Species Common brandling worm (Eisenia fetida)
MiRBase ID
Paralogues Efe-Mir-67-P1  Efe-Mir-67-P3 
Orthologues Aae-Mir-67  Asu-Mir-67  Bge-Mir-67  Cbr-Mir-67  Cel-Mir-67  Cte-Mir-67  Dan-Mir-67  Dme-Mir-67  Dmo-Mir-67  Dpu-Mir-67  Hme-Mir-67  Isc-Mir-67  Lan-Mir-67  Lgi-Mir-67 
Node of Origin (locus) E. fetida
Node of Origin (family) Protostomia
Genome context
(Efe_combined)
Efet.01.29421: 209-271 [-]
Precursor
(pre-Mir +30nt flank)
GCAGCUGGAGGAUGUAUUGCAAGGAGUCUGACCUUAUUCCGUGGUGUUGGGAUGGUUAAACUGGCCUCAUCACAACCUACUUGAAUAAGGUAGGACGCCCAGCACAGAACAGCCAAUCAGCGU
Get precursor sequence
Structure
        10          20        30        40         50        60 
GCAGCUGGAGGAUGUAU--   AA  A    G         C-|   U    G   GGUUAAA 
                   UGC  GG GUCU ACCUUAUUC  GUGG GUUG GAU       \
                   ACG  CC CAGG UGGAAUAAG  CAUC CAAC CUA       C
UGCGACUAACCGACAAGAC   AC  G    A         UU^   -    A   CUCCGGU 
 120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Efe-Mir-67-P2_5p

MirBase accessionNone
Sequence
0- ACCUUAUUCCGUGGUGUUGGGAU -23
Get sequence
Seed sequenceCCUUAUU
Co-mature sequence

Efe-Mir-67-P2_3p

MirBase accessionNone
Sequence
40- CACAACCUACUUGAAUAAGGUAG -63
Get sequence
Seed sequenceACAACCU