MirGeneDB

Gene name

Efe-Mir-67-P1

Family name MIR-67 (all species)
Species Common brandling worm (Eisenia fetida)
MiRBase ID
Paralogues Efe-Mir-67-P2  Efe-Mir-67-P3 
Orthologues Aae-Mir-67  Asu-Mir-67  Bge-Mir-67  Cbr-Mir-67  Cel-Mir-67  Cte-Mir-67  Dan-Mir-67  Dme-Mir-67  Dmo-Mir-67  Dpu-Mir-67  Hme-Mir-67  Isc-Mir-67  Lan-Mir-67  Lgi-Mir-67 
Node of Origin (locus) E. fetida
Node of Origin (family) Protostomia
Genome context
(Efe_combined)
Efet.01.111281: 4953-5013 [+]
Precursor
(pre-Mir +30nt flank)
AACUUCGUCUUUGAGUAGCCUGUGACACUGCCUUAUUCAGUAGAGUCGUGAUGGUGACAAGAAACUCAUCACAACCUACAUGAAUGGGGUAACGGAACGGGAUGGAACUGCGAAUCGUACA
Get precursor sequence
Structure
        10          20        30         40        50          
AACUUCGUCUUUGAGUAG--     GACAC           -|   A  C      GUGACA 
                    CCUGU     UGCCUUAUUCA GUAG GU GUGAUG      \
                    GGGCA     AUGGGGUAAGU CAUC CA CACUAC      A
ACAUGCUAAGCGUCAAGGUA     AGGCA           A^   -  A      UCAAAG 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
To
Star sequence

Efe-Mir-67-P1_5p*

MirBase accessionNone
Sequence
0- CCUUAUUCAGUAGAGUCGUGAUG -23
Get sequence
Mature sequence

Efe-Mir-67-P1_3p

MirBase accessionNone
Sequence
38- UCACAACCUACAUGAAUGGGGUA -61
Get sequence
Seed sequenceCACAACC