MirGeneDB

Gene name

Cbr-Mir-67

Family name MIR-67 (all species)
Species Roundworm (Caenorhabditis briggsae)
MiRBase ID cbr-mir-67
Paralogues
Orthologues Aae-Mir-67  Asu-Mir-67  Bge-Mir-67  Cel-Mir-67  Cgi-Mir-67-P4  Cgi-Mir-67-P5  Cgi-Mir-67-P6  Cte-Mir-67  Dan-Mir-67  Dan-Mir-67-as  Dme-Mir-67  Dme-Mir-67-as  Dmo-Mir-67  Dpu-Mir-67  Efe-Mir-67-P1  Efe-Mir-67-P2  Efe-Mir-67-P3  Hme-Mir-67  Isc-Mir-67  Lan-Mir-67  Lgi-Mir-67  Tca-Mir-67-v1  Tca-Mir-67-v2  Tca-Mir-67-v3 
Node of Origin (locus) Protostomia
Node of Origin (family) Protostomia
Genome context
(CB4)
III: 4112596-4112663 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUUAUUCCUAAAAUUCUAGAUAUUUCGAUCAACUCAUUCUGCUGGUUGUUAUGCUGACAAUUGAUGAUUAAGCAUCACAACCUCCUAGAAAGAGUAGACCGAUUCUAUCUUAUCUUUUUACGUAUUUA
Get precursor sequence
Structure
        10         20         30        40         50        60   
UUUAUUCCUAAAAUUCU-     UU-   A  A    A     CU-|     U   CUGACAAUU 
                  AGAUA   UCG UC ACUC UUCUG   GGUUGU AUG         \
                  UCUAU   AGC AG UGAG AAGAU   CCAACA UAC         G
AUUUAUGCAUUUUUCUAU     CUU   C  A    A     CCU^     C   GAAUUAGUA 
      120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 Cb Ea Ma Yo
Mature sequence

Cbr-Mir-67_5p

MirBase accessionNone
Sequence
0- AACUCAUUCUGCUGGUUGUUAUG -23
Get sequence
Seed sequenceACUCAUU
Co-mature sequence

Cbr-Mir-67_3p

MirBase accessionMIMAT0000480
Sequence
44- UCACAACCUCCUAGAAAGAGUAGA -68
Get sequence
Seed sequenceCACAACC