MirGeneDB

Gene name

Cel-Mir-67

Family name MIR-67 (all species)
Species Roundworm (Caenorhabditis elegans)
MiRBase ID cel-mir-67
Paralogues
Orthologues Aae-Mir-67  Asu-Mir-67  Bge-Mir-67  Cbr-Mir-67  Cgi-Mir-67-P4  Cgi-Mir-67-P5  Cgi-Mir-67-P6  Cte-Mir-67  Dan-Mir-67  Dan-Mir-67-as  Dme-Mir-67  Dme-Mir-67-as  Dmo-Mir-67  Dpu-Mir-67  Efe-Mir-67-P1  Efe-Mir-67-P2  Efe-Mir-67-P3  Hme-Mir-67  Isc-Mir-67  Lan-Mir-67  Lgi-Mir-67  Tca-Mir-67-v1  Tca-Mir-67-v2  Tca-Mir-67-v3 
Node of Origin (locus) Protostomia
Node of Origin (family) Protostomia
Genome context
(ce11)
chrIII: 5931364-5931428 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UAUUCCAACUCGAUCAAAGAUUCGUCGAUCCGCUCAUUCUGCCGGUUGUUAUGCUAUUAUCAGAUUAAGCAUCACAACCUCCUAGAAAGAGUAGAUCGAUUUUAAAACUUUGAAUUUCGUUUAUU
Get precursor sequence
Structure
        10        20          30        40         50        60 
UAUUCCAACUCGAUCAAAGAUUC--       CG   A     CC-|     U   CUAUUAU 
                         GUCGAUC  CUC UUCUG   GGUUGU AUG       C
                         UAGCUAG  GAG AAGAU   CCAACA UAC       A
UUAUUUGCUUUAAGUUUCAAAAUUU       AU   A     CCU^     C   GAAUUAG 
   120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Wt Da Ea Mi Yo Yo
Star sequence

Cel-Mir-67_5p*

MirBase accessionMIMAT0020316
Sequence
0- CGCUCAUUCUGCCGGUUGUUAUG -23
Get sequence
Mature sequence

Cel-Mir-67_3p

MirBase accessionMIMAT0000039
Sequence
41- UCACAACCUCCUAGAAAGAGUAGA -65
Get sequence
Seed sequenceCACAACC
Validated targets microrna.org: MIMAT0000039
TargetScanWorm: cel-miR-67