MirGeneDB

Gene name

Asu-Mir-67

Family name MIR-67 (all species)
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-67
Paralogues
Orthologues Aae-Mir-67  Bge-Mir-67  Cbr-Mir-67  Cel-Mir-67  Cgi-Mir-67-P4  Cgi-Mir-67-P5  Cgi-Mir-67-P6  Cte-Mir-67  Dan-Mir-67  Dan-Mir-67-as  Dme-Mir-67  Dme-Mir-67-as  Dmo-Mir-67  Dpu-Mir-67  Efe-Mir-67-P1  Efe-Mir-67-P2  Efe-Mir-67-P3  Hme-Mir-67  Isc-Mir-67  Lan-Mir-67  Lgi-Mir-67  Tca-Mir-67-v1  Tca-Mir-67-v2  Tca-Mir-67-v3 
Node of Origin (locus) Protostomia
Node of Origin (family) Protostomia
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold214: 388322-388383 [+]
Precursor
(pre-Mir +30nt flank)
AGUGUAGCCAUCUUCUGCUCGAGGGCACUUAGCUCGCUCGGCUGGUUGUUAGAUGUUUCUGCUGUUCAUCACAACCUCCUUGAGUGAGUUGAAAGCCCUCAUGCUGACGAAGCGAUCUUCAU
Get precursor sequence
Structure
        10        20          30        40         50        60 
AGUGUAGCCAUCUUCUGCUC--      AC             CU-|     UA    UUUCU 
                      GAGGGC  UUAGCUCGCUCGG   GGUUGU  GAUG     \
                      CUCCCG  AGUUGAGUGAGUU   CCAACA  CUAC     G
UACUUCUAGCGAAGCAGUCGUA      AA             CCU^     --    UUGUC 
120       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsNo
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-67_5p*

MirBase accessionMIMAT0021523
Sequence
0- AGCUCGCUCGGCUGGUUGUUAGAUG -25
Get sequence
Mature sequence

Asu-Mir-67_3p (predicted)

MirBase accessionMIMAT0021524
Sequence
38- UCACAACCUCCUUGAGUGAGUUGA -62
Get sequence
Seed sequenceCACAACC