
MirGeneDB ID


Family name MIR-67 (all species)
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-67
Orthologues Aae-Mir-67  Bge-Mir-67  Cbr-Mir-67  Cel-Mir-67  Cgi-Mir-67-P4  Cgi-Mir-67-P5  Cgi-Mir-67-P6  Cte-Mir-67  Dan-Mir-67  Dan-Mir-67-as  Dme-Mir-67  Dme-Mir-67-as  Dmo-Mir-67  Dpu-Mir-67  Efe-Mir-67-P1  Efe-Mir-67-P2  Efe-Mir-67-P3  Hme-Mir-67  Isc-Mir-67  Lan-Mir-67  Lgi-Mir-67  Tca-Mir-67-v1  Tca-Mir-67-v2  Tca-Mir-67-v3 
Node of Origin (locus) Protostomia
Node of Origin (family) Protostomia
Genome context
Scaffold214: 388322-388383 [+]
(pre-Mir +30nt flank)
Get precursor sequence
        10        20          30        40         50        60 
AGUGUAGCCAUCUUCUGCUC--      AC             CU-|     UA    UUUCU 
                      GAGGGC  UUAGCUCGCUCGG   GGUUGU  GAUG     \
                      CUCCCG  AGUUGAGUGAGUU   CCAACA  CUAC     G
UACUUCUAGCGAAGCAGUCGUA      AA             CCU^     --    UUGUC 
120       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU Unknown
Tissue expression
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence


MirBase accessionMIMAT0021523
Get sequence
Mature sequence

Asu-Mir-67_3p (predicted)

MirBase accessionMIMAT0021524
Get sequence