MirGeneDB

MirGeneDB ID

Spu-Mir-2012

Family name MIR-2012 (all species)
Seed AGUACUG
Species Purple sea urchin (Strongylocentrotus purpuratus)
MiRBase ID spu-mir-2012
Paralogues
Orthologues Pfl-Mir-2012  Pmi-Mir-2012  Sko-Mir-2012 
Node of Origin (locus) Ambulacraria
Node of Origin (family) Ambulacraria
Genome context
(Spur_3.1)
Scaffold111: 176731-176794 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GACGAACGGGACACAUUGCUGGGUUCUUGAUAGUACUGGCAUAUGGACAUUGUUGUAAUAAUCUUACUCUCAAUGUUCAUCUGUCCGUACUGCCAAGUGCCUGGCCUUACAUUCAUUCAUCCGC
Get precursor sequence
Structure
        10          20        30        40        50        60 
GACGAACGGGACACAUU--| UG   U    A      U    U          UUGUAAUA 
                   GC  GGU CUUG UAGUAC GGCA AUGGACAUUG        A
                   CG  CCG GAAC GUCAUG CUGU UACUUGUAAC        U
CGCCUACUUACUUACAUUC^ GU   U    C      C    C          UCUCAUUC 
  120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
32 Bl Eg Ga Ov Pl To To
Mature sequence

Spu-Mir-2012_5p

MirBase accessionMIMAT0009741
Sequence
0- UAGUACUGGCAUAUGGACAUUG -22
Get sequence
Star sequence

Spu-Mir-2012_3p*

MirBase accessionNone
Sequence
42- AUGUUCAUCUGUCCGUACUGCC -64
Get sequence