MirGeneDB

MirGeneDB ID

Rno-Mir-28-P2

Family name MIR-28 (all species)
Seed CGAGGAG
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-151
Paralogues Rno-Mir-28-P1  Rno-Mir-28-P3 
Orthologues Bta-Mir-28-P2  Cfa-Mir-28-P2  Cpo-Mir-28-P2  Dno-Mir-28-P2  Ete-Mir-28-P2  Hsa-Mir-28-P2  Mml-Mir-28-P2  Mmu-Mir-28-P2  Ocu-Mir-28-P2 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(rn6)
chr7: 114485572-114485628 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAGCACAGAUGAUGGAGCGCUUUCCUGCCCUCGAGGAGCUCACAGUCUAGUAUGUCUCCUCCCUACUAGACUGAGGCUCCUUGAGGACAGGGAUCGUCAUACUCACCUCCCGCCAGG
Get precursor sequence
Structure
        10            20        30        40        50        
GAGCACAGAUGAUGGAG----| CU      C            CA          UGUCU 
                     CG  UUCCUG CCUCGAGGAGCU  CAGUCUAGUA     \
                     GC  AGGGAC GGAGUUCCUCGG  GUCAGAUCAU     C
GGACCGCCCUCCACUCAUACU^ U-      A            A-          CCCUC 
     110       100         90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-28-P2_5p

MirBase accessionMIMAT0000613
Sequence
0- UCGAGGAGCUCACAGUCUAGUA -22
Get sequence
Validated targets microrna.org: MIMAT0000613
TargetScanVert: rno-miR-151-5p
miRDB: MIMAT0000613
Co-mature sequence

Rno-Mir-28-P2_3p

MirBase accessionMIMAT0000614
Sequence
35- CUAGACUGAGGCUCCUUGAGGA -57
Get sequence
Validated targets microrna.org: MIMAT0000614
TargetScanVert: rno-miR-151-3p
miRDB: MIMAT0000614