MirGeneDB ID | Pcr-Mir-2-o159 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | MIR-2 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | Tiger flatworm (Prostheceraeus crozieri ) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | Pcr-Mir-2-o160 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Gsp-Mir-2 Ple-Mir-2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | P. crozeri | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (GCA_907163375.1_PROCRO_GENOME_genomic) |
CAJQUW010002633.1: 636086-636150 [+] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs (< 50kb from Mir-2-o159) |
Mir-71-v1
CAJQUW010002633.1: 635983-636044 [+]
Ensembl
Mir-71-v2 CAJQUW010002633.1: 635985-636042 [+] Ensembl Mir-2-o159 CAJQUW010002633.1: 636086-636150 [+] Ensembl Mir-2-o160 CAJQUW010002633.1: 636207-636265 [+] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | CACAGCC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
CGGUCGUCUAUCAUCAUACCAUCUCGUUGGUCGUCAAUAUUGUCUGUCGGUAGUGAUUCAAUGUAAAAACUUAUCACAGCCAGUAUUGAUGAGCCAGUUGGAAGGUUUGAAGCCACACUUUUCCUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 60 CGGUCGUCUAUCAUCAU-- A CG -| U C GUGAUUCAA ACC UCU UUGG UCGUCAAUAUUG CUGU GGUA \ UGG AGG GACC AGUAGUUAUGAC GACA CUAU U UCCUUUUCACACCGAAGUU A UU G^ C - UCAAAAAUG 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | It is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and how the multiple paralogues in lophotrochozoans relate to the four Mir-2 genes in arthropods. Thus all lophotrochozoan genes aside from Mir-2-P12 are classified as orphans pending further data and analysis. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | CNNC at 3p(+17), UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Pcr-Mir-2-o159_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- UCGUCAAUAUUGUCUGUCGGUA -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Pcr-Mir-2-o159_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
43- UCACAGCCAGUAUUGAUGAGCC -65
Get sequence
|