MirGeneDB

MirGeneDB ID

Mmu-Mir-423

Family name MIR-423 (all species)
Seed GAGGGGC
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-423
Paralogues
Orthologues Bta-Mir-423  Cfa-Mir-423  Cpo-Mir-423  Dno-Mir-423  Ete-Mir-423  Hsa-Mir-423  Mml-Mir-423  Ocu-Mir-423  Rno-Mir-423 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(mm10)
chr11: 77078086-77078144 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AAACUUGUGAGGAAAUAAAGGAAGUUAGGCUGAGGGGCAGAGAGCGAGACUUUUCUAUUUUCCAAAAGCUCGGUCUGAGGCCCCUCAGUCUUGCUUCCUACCCCGCGCUUGAGUUUCUC
Get precursor sequence
Structure
        10          20        30        40         50         
AAACUUGUGAGGAAAUAA--       U            AG-|  G    A    UCUAU 
                    AGGAAGU AGGCUGAGGGGC   AGA CGAG CUUU     \
                    UCCUUCG UCUGACUCCCCG   UCU GCUC GAAA     U
CUCUUUGAGUUCGCGCCCCA       U            GAG^  G    -    ACCUU 
       110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-423_5p

MirBase accessionMIMAT0004825
Sequence
0- UGAGGGGCAGAGAGCGAGACUUU -23
Get sequence
Validated targets microrna.org: MIMAT0004825
TargetScanVert: mmu-miR-423-5p
miRDB: MIMAT0004825
Star sequence

Mmu-Mir-423_3p*

MirBase accessionMIMAT0003454
Sequence
36- AGCUCGGUCUGAGGCCCCUCAGU -59
Get sequence
Validated targets microrna.org: MIMAT0003454
TargetScanVert: mmu-miR-423-3p
miRDB: MIMAT0003454