MirGeneDB

MirGeneDB ID

Mmu-Mir-324

Family name MIR-324 (all species)
Seed GCAUCCC
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-324
Paralogues
Orthologues Bta-Mir-324  Cfa-Mir-324  Cpo-Mir-324  Dno-Mir-324  Ete-Mir-324  Hsa-Mir-324  Mml-Mir-324  Ocu-Mir-324  Rno-Mir-324 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(mm10)
chr11: 70012060-70012116 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCCUCCAGAAGAGAACUGACUAUGCCUCCUCGCAUCCCCUAGGGCAUUGGUGUAAAGCUGGAGACCCACUGCCCCAGGUGCUGCUGGGGGUUGUAGUCUGACCCAACUGUGAAGAAA
Get precursor sequence
Structure
        10          20        30        40        50        
CCCUCCAGAAGAGAACU--|     GC     C   UCC   A     U   U  AAAG 
                   GACUAU  CUCCU GCA   CCU GGGCA UGG GU    C
                   CUGAUG  GGGGG CGU   GGA CCCGU ACC CA    U
AAAGAAGUGUCAACCCAGU^     UU     U   CGU   C     C   -  GAGG 
     110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-324_5p

MirBase accessionMIMAT0000555
Sequence
0- CGCAUCCCCUAGGGCAUUGGUGU -23
Get sequence
Validated targets microrna.org: MIMAT0000555
TargetScanVert: mmu-miR-324-5p
miRDB: MIMAT0000555
Star sequence

Mmu-Mir-324_3p*

MirBase accessionMIMAT0000556
Sequence
35- CCACUGCCCCAGGUGCUGCUGG -57
Get sequence
Validated targets microrna.org: MIMAT0000556
TargetScanVert: mmu-miR-324-3p
miRDB: MIMAT0000556