MirGeneDB

MirGeneDB ID

Hsa-Mir-935-v2

Family name MIR-935 (all species)
Seed CAGUUAC
Species Human (Homo sapiens)
MiRBase ID hsa-mir-935
Paralogues Hsa-Mir-935-v1 
Orthologues Bta-Mir-935-v2  Cfa-Mir-935-v2  Dno-Mir-935-v2  Mml-Mir-935-v2  Mmu-Mir-935-v2  Rno-Mir-935-v2 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(hg38)
chr19: 53982325-53982384 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-935-v2)
Mir-935-v1 chr19: 53982325-53982384 [+] UCSC Ensembl
Mir-935-v2 chr19: 53982325-53982384 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUGCUCAAGGCCGGCGGGGGCGCGGGCGGCAGUGGCGGGAGCGGCCCCUCGGCCAUCCUCCGUCUGCCCAGUUACCGCUUCCGCUACCGCCGCCGCUCCCGCUCUAGCUCCCGCUCCAGC
Get precursor sequence
Structure
        10           20        30        40        50         
CUGCUCAAGGCCGGCGG---|  C    G    A             CCC  C   CAUCC 
                    GGG GCGG CGGC GUGGCGGGAGCGG   CU GGC     U
                    CCC CGCC GCCG CAUCGCCUUCGCC   GA CCG     C
CGACCUCGCCCUCGAUCUCG^  U    -    C             AUU  C   UCUGC 
.       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
CommentMir-935 was rejected in Fromm et al. (2015).
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Star sequence

Hsa-Mir-935-v2_5p*

MirBase accessionNone
Sequence
0- AGUGGCGGGAGCGGCCCCUCGGC -23
Get sequence
Mature sequence

Hsa-Mir-935-v2_3p

MirBase accessionMIMAT0004978
Sequence
37- CCAGUUACCGCUUCCGCUACCGC -60
Get sequence
Validated targets microrna.org: MIMAT0004978
TargetScanVert: hsa-miR-935
TargetMiner: hsa-miR-935
miRDB: MIMAT0004978