MirGeneDB

MirGeneDB ID

Hsa-Mir-3173

Family name MIR-3173 (all species)
Seed GCCCUGC
Species Human (Homo sapiens)
MiRBase ID hsa-mir-3173
Paralogues
Orthologues Mml-Mir-3173 
Node of Origin (locus) Catarrhini
Node of Origin (family) Catarrhini
Genome context
(hg38)
chr14: 95137922-95137982 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAGUCUUUGUUGGUCUUGGGCCAGCUUCCCUGCCCUGCCUGUUUUCUCCUUUGUGAUUUUAUGAGAACAAAGGAGGAAAUAGGCAGGCCAGGGAAACGAUCUCUCUCCCUCUCUUGUGCCG
Get precursor sequence
Structure
        10         20        30        40        50        60
GAGUCUUUGUUGGUCUU-|  CCAGC       C                    UGAUUU 
                  GGG     UUCCCUG CCUGCCUGUUUUCUCCUUUG      U
                  CUC     AAGGGAC GGACGGAUAAAGGAGGAAAC      A
GCCGUGUUCUCUCCCUCU^  UAGCA       C                    AAGAGU 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer cut +1 on the 3p arm relative to what is annotated here.
3' NTU Yes
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Mature sequence

Hsa-Mir-3173_5p

MirBase accessionMIMAT0019214
Sequence
0- UGCCCUGCCUGUUUUCUCCUUUG -23
Get sequence
Validated targets TargetScanVert: hsa-miR-3173-5p
TargetMiner: hsa-miR-3173-5p
miRDB: MIMAT0019214
Star sequence

Hsa-Mir-3173_3p*

MirBase accessionMIMAT0015048
Sequence
39- AAGGAGGAAAUAGGCAGGCCAG -61
Get sequence
Validated targets microrna.org: MIMAT0015048
TargetScanVert: hsa-miR-3173-3p
TargetMiner: hsa-miR-3173-3p
miRDB: MIMAT0015048