MirGeneDB

MirGeneDB ID

Hme-Mir-2755

Family name MIR-2755 (all species)
Seed ACCCUGU
Species Longwing butterfly (Heliconius melpomene)
MiRBase ID hme-mir-2755
Paralogues
Orthologues
Node of Origin (locus) H. melpomene
Node of Origin (family) H. melpomene
Genome context
(Hmel_1)
HE671518: 150664-150723 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AAGGAUAAGGAAACAUGGGUUUUGGUAGAACAAGGUGGCCUAGCAGCGUGUUUUCCUCUAAGUUUUGCACCCUGUCAGACCAUACUUGUUCUAACGUACCUAUUAUCACAAUGAAGACAC
Get precursor sequence
Structure
        10           20        30         40        50         
AAGGAUAAGGAAACAUG---|  UU  G         -    C  AG   C    UUUCCUC 
                    GGU  UG UAGAACAAG GUGG CU  CAG GUGU       \
                    CCA  GC AUCUUGUUC UACC GA  GUC CACG       U
CACAGAAGUAACACUAUUAU^  U-  A         A    A  CU   C    UUUUGAA 
.       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
CommentThere is a Drosha site -2 on the 5p arm relative to what is annotated here.
3' NTU No
MotifsNo
Tissue expression
 +
Ad Ad Fe Fe Fe Fe Ma Ma
Star sequence

Hme-Mir-2755_5p*

MirBase accessionNone
Sequence
0- CAAGGUGGCCUAGCAGCGUGUU -22
Get sequence
Mature sequence

Hme-Mir-2755_3p

MirBase accessionMIMAT0024952
Sequence
37- CACCCUGUCAGACCAUACUUGUU -60
Get sequence