MirGeneDB

MirGeneDB ID

Dre-Mir-2191

Family name MIR-2191 (all species)
Seed CACACCU
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-2191
Paralogues
Orthologues
Node of Origin (locus) D. rerio
Node of Origin (family) D. rerio
Genome context
(danRer11)
chr23: 36790250-36790310 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCGGUGCCUUGCUCAAGGGUCUCACCUCUGCCAUGGUAUUGAAGGUGGUAGAGAGUGUUUGUACAUUCACUCACACCUACAAUCCCUGGCAGUACUGAGACUCAAACCUGCAAUCUUUGGA
Get precursor sequence
Structure
        10          20        30        40        50        60
UCGGUGCCUUGCUCAAG--|      CCU      U  U    A     GU  AGAGUGUU 
                   GGUCUCA   CUGCCA GG AUUG AGGUG  AG        U
                   UCAGAGU   GACGGU CC UAAC UCCAC  UC        G
AGGUUUCUAACGUCCAAAC^      CAU      C  -    A     AC  ACUUACAU 
 .       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-2191_5p*

MirBase accessionNone
Sequence
0- CCAUGGUAUUGAAGGUGGUAGA -22
Get sequence
Mature sequence

Dre-Mir-2191_3p

MirBase accessionMIMAT0011300
Sequence
40- UCACACCUACAAUCCCUGGCA -61
Get sequence
Validated targets TargetScanFish: dre-miR-2191