MirGeneDB

MirGeneDB ID

Dan-Novel-3

Family name DAN-NOVEL-3 (all species)
Seed AAGCGCU
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues
Orthologues
Node of Origin (locus) D. ananassae
Node of Origin (family) D. ananassae
Genome context
(Dana_caf1)
scaffold_12903: 550138-550198 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UAAAGGAUAACCCCCAGAUAAGUGUAGUACUCCUAGUGGUAGAGACGGCUUAUAUUUUUUCAUCCAUAUAAGCGCUCUAACCACUAGAAGAUACUCUGCUUAUAGAGUCUUCAGGAUCUUC
Get precursor sequence
Structure
        10         20         30         40        50        60
UAAAGGAUAACCCCCAG-      GU    -  C       -|    A  G      UUUUU 
                  AUAAGU  AGUA CU CUAGUGG UAGAG CG CUUAUA     U
                  UAUUCG  UCAU GA GAUCACC AUCUC GC GAAUAU     C
CUUCUAGGACUUCUGAGA      UC    A  A       A^    -  -      ACCUA 
 .       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Star sequence

Dan-Novel-3_5p*

MirBase accessionNone
Sequence
0- UCCUAGUGGUAGAGACGGCUUAUA -24
Get sequence
Mature sequence

Dan-Novel-3_3p

MirBase accessionNone
Sequence
38- UAAGCGCUCUAACCACUAGAAGA -61
Get sequence