MirGeneDB

MirGeneDB ID

Dan-Novel-1

Family name DAN-NOVEL-1 (all species)
Seed ACUUUGA
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues
Orthologues
Node of Origin (locus) D. ananassae
Node of Origin (family) D. ananassae
Genome context
(Dana_caf1)
scaffold_12903: 534990-535045 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AUAUUAAAUAUUACUUAGUCUCUUUUCAUUUACUUUGAGUAAUGUUUGUAUUGUAUUUUCUAAAUACAUUCUUUAUUCCAAGUAGAUGAAGUGAUUUUCGAUCAUCAGUUGAAAUA
Get precursor sequence
Structure
        10        20          30        40        50       
AUAUUAAAUAUUACUUAGUC--| U            U      UGUU      GUAU 
                      UC UUUCAUUUACUU GAGUAA    UGUAUU    U
                      AG GAAGUAGAUGAA CUUAUU    ACAUAA    U
AUAAAGUUGACUACUAGCUUUU^ U            C      UCUU      AUCU 
    110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Mature sequence

Dan-Novel-1_5p

MirBase accessionNone
Sequence
0- UACUUUGAGUAAUGUUUGUAUU -22
Get sequence
Co-mature sequence

Dan-Novel-1_3p

MirBase accessionNone
Sequence
34- UACAUUCUUUAUUCCAAGUAGA -56
Get sequence