MirGeneDB

MirGeneDB ID

Dan-Mir-987

Family name MIR-987 (all species)
Seed AAAGUAA
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues
Orthologues Dme-Mir-987  Dmo-Mir-987 
Node of Origin (locus) Drosophila
Node of Origin (family) Drosophila
Genome context
(Dana_caf1)
scaffold_12430: 12744-12809 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
ACGGAAAAAUGUACAAUGUUGGACUGUGCUUAAAGUAAAUAGUCUGGAUUGAUGAAAGUUGUAUUCGAGAAUUCAUCAACAGGCAUUUACUUCAACUGCAGUUCGAACGAAAUUCAACAGGAUAAU
Get precursor sequence
Structure
        10          20        30        40        50        60    
ACGGAAAAAUGUACAAUG--|        GC  A        A     GA       AAGUUGUA 
                    UUGGACUGU  UU AAGUAAAU GUCUG  UUGAUGA        \
                    AGCUUGACG  AA UUCAUUUA CGGAC  AACUACU        U
UAAUAGGACAACUUAAAGCA^        UC  C        -     --       UAAGAGCU 
    120       110       100        90         80          70
Deep sequencing
Go to detailed chart
CommentThere are Dicer sites +1 and -1 relative to what is annotated here.
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Da
Mature sequence

Dan-Mir-987_5p

MirBase accessionNone
Sequence
0- UAAAGUAAAUAGUCUGGAUUGAUGA -25
Get sequence
Star sequence

Dan-Mir-987_3p*

MirBase accessionNone
Sequence
44- AUCAACAGGCAUUUACUUCAAC -66
Get sequence