MirGeneDB

MirGeneDB ID

Dan-Mir-957

Family name MIR-957 (all species)
Seed GAAACCG
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues
Orthologues Aae-Mir-957  Dme-Mir-957  Dmo-Mir-957 
Node of Origin (locus) Diptera
Node of Origin (family) Diptera
Genome context
(Dana_caf1)
scaffold_13337: 22247699-22247766 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AUAUAGUAAUAUAUACUGCCUACAAUGGCCCUUAGUUUUCGACGUGUUUUGGUGUGCAGGGGAGUUCUAUUCCGAUUGAAACCGUCCAAAACUGAGGCCAACUGUGAGGCGUGAGCAUCUAAAAAUUA
Get precursor sequence
Structure
        10         20          30        40        50        60    
AUAUAGUAAUAUAUACU-    -   A-|    C        C    U    UG  GUGCAGGGGA 
                  GCCU ACA  UGGCC UUAGUUUU GACG GUUU  GU          \
                  CGGA UGU  ACCGG AGUCAAAA CUGC CAAA  UA          G
AUUAAAAAUCUACGAGUG    G   CA^    -        C    -    GU  GCCUUAUCUU 
      120       110       100         90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Da
Star sequence

Dan-Mir-957_5p*

MirBase accessionNone
Sequence
0- CUUAGUUUUCGACGUGUUUUGGU -23
Get sequence
Mature sequence

Dan-Mir-957_3p

MirBase accessionNone
Sequence
46- UGAAACCGUCCAAAACUGAGGC -68
Get sequence