MirGeneDB

MirGeneDB ID

Dan-Mir-1006

Family name MIR-1006 (all species)
Seed AAAUUCG
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues
Orthologues Dme-Mir-1006  Dmo-Mir-1006 
Node of Origin (locus) Drosophila
Node of Origin (family) Drosophila
Genome context
(Dana_caf1)
scaffold_12943: 3938340-3938403 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
CGCAUCCUGUCGACCCGUGUCAACUUCCAGGUGAGUUUGAAAUUGAAAUGCGUAAAUUGUUUGGUACAAUUUAAAUUCGAUUUCUUAUUCAUAGGUCCAAUACCAGCUGAUCUUCUGCCUGUGG
Get precursor sequence
Structure
        10        20           30        40        50        60 
CGCAUCCUGUCGACCCGUGUCAACUU---| AG      UU         AUGCGUAAAUUGU 
                             CC  GUGAGU  GAAAUUGAA             U
                             GG  UACUUA  CUUUAGCUU             U
GGUGUCCGUCUUCUAGUCGACCAUAACCU^ A-      UU         AAAUUUAACAUGG 
  120       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Star sequence

Dan-Mir-1006_5p*

MirBase accessionNone
Sequence
0- GUGAGUUUGAAAUUGAAAUGCGUAAA -26
Get sequence
Mature sequence

Dan-Mir-1006_3p

MirBase accessionNone
Sequence
41- UAAAUUCGAUUUCUUAUUCAUAG -64
Get sequence