MirGeneDB

MirGeneDB ID

Cli-Mir-9616

Family name MIR-9616 (all species)
Seed UGAGCUG
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-9616
Paralogues
Orthologues
Node of Origin (locus) C. livia
Node of Origin (family) C. livia
Genome context
(colLiv2)
scaffold32: 1124437-1124505 [-]
Precursor
(pre-Mir +30nt flank)
CGACAACCUGUGGGCAGCCUCAGUGGGGGCUGCGGCCUGGGGCAGCGCAAACCCCACUUUAGGGUGGAAAACACAAGGUUGAGCUGAUCCAGGCCUGGCCUCCCCUCUGGCCCAUACUCCCCUGCCCCU
Get precursor sequence
Structure
        10          20        30        40        50        60     
CGACAACCUGUGGGCAG--| UC  U        C       GG    GCA    CCACUUUAGGG 
                   CC  AG GGGGGCUG GGCCUGG  CAGC   AACC           \
                   GG  UC CCUCCGGU CCGGACC  GUCG   UUGG           U
UCCCCGUCCCCUCAUACCC^ UC  C        -       UA    AG-    AACACAAAAGG 
       120       110       100         90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Cli-Mir-9616_5p*

MirBase accessionMIMAT0038721
Sequence
0- UGCGGCCUGGGGCAGCGCAAACC -23
Get sequence
Mature sequence

Cli-Mir-9616_3p

MirBase accessionMIMAT0038722
Sequence
48- UUGAGCUGAUCCAGGCCUGGC -69
Get sequence