MirGeneDB

MirGeneDB ID

Cin-Mir-4060

Family name MIR-4060 (all species)
Seed UUUCACU
Species Sea Squirt (Ciona intestinalis)
MiRBase ID cin-mir-4060
Paralogues
Orthologues
Node of Origin (locus) C. intestinalis
Node of Origin (family) C. intestinalis
Genome context
(ci3)
HT000174.1: 91188-91245 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-4060)
Mir-4078 HT000174.1: 91084-91136 [+] UCSC Ensembl
Mir-4060 HT000174.1: 91188-91245 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGUGGUUCAUAUUUUAUUCGUUGCGCUGCGAUUUCACUCUUUCAACUGUUGGUCGAAAUAUAUCCAGCCGUUGUUGCAGUGAAGUGAUCAGCGUAAUGCGCUACGUCAUCAAAACUGC
Get precursor sequence
Structure
        10          20        30         40        50        
UGUGGUUCAUAUUUUAUU--          CG-|       CUUU    U     UCGAA 
                    CGUUGCGCUG   AUUUCACU    CAAC GUUGG     \
                    GUAAUGCGAC   UGAAGUGA    GUUG CGACC     A
CGUCAAAACUACUGCAUCGC          UAG^       CGUU    C     UAUAU 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Cr Cr Cr Cr Cr Cr Cr Cr Cr Cr Ga La La
Mature sequence

Cin-Mir-4060_5p

MirBase accessionMIMAT0016608
Sequence
0- AUUUCACUCUUUCAACUGUUGG -22
Get sequence
Co-mature sequence

Cin-Mir-4060_3p

MirBase accessionMIMAT0016609
Sequence
35- AGCCGUUGUUGCAGUGAAGUGAU -58
Get sequence