MirGeneDB

MirGeneDB ID

Cin-Mir-1502-P2

Family name MIR-1502 (all species)
Seed GAACUUU
Species Sea Squirt (Ciona intestinalis)
MiRBase ID cin-mir-1502b
Paralogues Cin-Mir-1502-P1  Cin-Mir-1502-P3  Cin-Mir-1502-P4 
Orthologues
Node of Origin (locus) C. intestinalis
Node of Origin (family) C. intestinalis
Genome context
(ci3)
3: 569083-569140 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-1502-P2)
Mir-4000-P10 3: 568497-568582 [+] UCSC Ensembl
Mir-1502-P4 3: 568849-568908 [+] UCSC Ensembl
Mir-4018-P1 3: 568964-569018 [+] UCSC Ensembl
Mir-1502-P2 3: 569083-569140 [+] UCSC Ensembl
Mir-1502-P1 3: 569197-569256 [+] UCSC Ensembl
Mir-4000-P11 3: 569327-569379 [+] UCSC Ensembl
Mir-4018-P2 3: 569570-569648 [+] UCSC Ensembl
Mir-1502-P3 3: 570975-571033 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUCAUCGGGGCAAUAAAGCUUCGGUUGAUUUGAACUUUACCACGAAAAGGUCUGUCAUAUAUAACACAGACUUUUCAGGUAGUUCACAAAAGCUGCGAGCCAAAGCAACUGCCCCGUC
Get precursor sequence
Structure
        10         20         30        40        50        60
CUCAUCGGGGCAAUAAA-    -|    GAUU      UU   AC      G     CAUA 
                  GCUU CGGUU    UGAACU  ACC  GAAAAG UCUGU    U
                  CGAG GUCGA    ACUUGA  UGG  CUUUUC AGACA    A
CUGCCCCGUCAACGAAAC    C^    AAAC      --   A-      -     CAAU 
      110       100        90          80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Cr Cr Cr Cr Cr Cr Cr Cr Cr Cr Ga La La
Mature sequence

Cin-Mir-1502-P2_5p

MirBase accessionMIMAT0016489
Sequence
0- UGAACUUUACCACGAAAAGGUCUGU -25
Get sequence
Star sequence

Cin-Mir-1502-P2_3p*

MirBase accessionMIMAT0016490
Sequence
37- AGACUUUUCAGGUAGUUCACA -58
Get sequence