MirGeneDB ID | Bfl-Mir-12494 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | MIR-12494 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | Florida lancelet (Branchiostoma floridae) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Bla-Mir-12494-P1 Bla-Mir-12494-P2a Bla-Mir-12494-P2b Bla-Mir-12494-P3 Bla-Mir-12494-P4 Bla-Mir-12494-P5 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | Branchiostoma | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Branchiostoma | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (GCF_000003815.2_Bfl_VNyyK_genomic) |
NC_049995.1: 9464332-9464391 [+] UCSC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | GGCCUAA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
GUUUAGAGAGAAAUCUGGGUUCCUCCAUGAAUCCGUGGUGAUUGUGGCCAUGUUGUUAAUCAGGUAUCAUGGCCUAAUUUCCUCGGAUUUAUGUCAAACCUUUCAUCAACAACAUCAAAUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 GUUUAGAGAGAAAUCUG---| CCUC U U U UUGUUAA GGUU CAUGAAUCCG GG GAUUG GGCCAUG \ CCAA GUAUUUAGGC CC UUAAU CCGGUAC U UAAACUACAACAACUACUUU^ ACU- U U - UAUGGAC . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | There are numerous paralogues of this gene family in B. floridae but because of the shallowing 454 sequencing no reads are detected for any loci. Thus annotation of this family awaits deeper small RNA sequencing. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Bfl-Mir-12494_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- AUCCGUGGUGAUUGUGGCCAUG -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Bfl-Mir-12494_3p (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
39- UGGCCUAAUUUCCUCGGAUUU -60
Get sequence
|