MirGeneDB

MirGeneDB ID

Aca-Mir-727-v1

Family name MIR-727 (all species)
Seed CAGUCUU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-727
Paralogues Aca-Mir-727-v2 
Orthologues Cpi-Mir-727  Dre-Mir-727-v1 
Node of Origin (locus) Osteichthyes
Node of Origin (family) Osteichthyes
Genome context
(anoCar2)
3: 28511685-28511749 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-727-v1)
Mir-727-v1 3: 28511685-28511749 [+] UCSC Ensembl
Mir-727-v2 3: 28511687-28511748 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGUGGAACUUGAUUGCCCUGUAUGUCAUUUUCAGUCUUCAAUUCCUCCCAGCCCGUUAAAUGGAAAAGGUGAGUUGAGGCGAGUUGAAGACUAAAAAUGCUGUGCAGAUUCAAGGUAACUUUCCC
Get precursor sequence
Structure
        10         20        30        40         50        60  
AGUGGAACUUGAUUGCC-|      U      C            CU  -    CCGUUAAAU 
                  CUGUAUG CAUUUU AGUCUUCAAUUC  CC CAGC         G
                  GACGUGU GUAAAA UCAGAAGUUGAG  GG GUUG         G
CCCUUUCAAUGGAACUUA^      C      A            C-  A    AGUGGAAAA 
   120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-727-v1_5p

MirBase accessionMIMAT0021987
Sequence
0- UCAGUCUUCAAUUCCUCCCAGC -22
Get sequence
Star sequence

Aca-Mir-727-v1_3p*

MirBase accessionMIMAT0021988
Sequence
44- UGAGGCGAGUUGAAGACUAAA -65
Get sequence