MirGeneDB

MirGeneDB ID

Aca-Mir-5417

Family name MIR-5417 (all species)
Seed CAUCCCA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-5417
Paralogues
Orthologues
Node of Origin (locus) A. carolinensis
Node of Origin (family) A. carolinensis
Genome context
(anoCar2)
GL343364.1: 1077044-1077099 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGGGAGACGCAGCUUCUGGCCGGGACUGAGGAGAGAAGGCGUGGGAAGGAGCGGGCUCCGGCGCUCAUCCCAGCCCCUUUUCUCCCCUGGACUGGCUGCCACGAGCGAGGAGAAAG
Get precursor sequence
Structure
        10          20        30        40         50       
GGGGAGACGCAGCUUCU--      GACUGA          C -|    AG    GGGC 
                   GGCCGG      GGAGAGAAGG G UGGGA  GAGC    U
                   UCGGUC      CCUCUUUUCC C ACCCU  CUCG    C
GAAAGAGGAGCGAGCACCG      AGGUCC          C G^    A-    CGGC 
    110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-5417_5p*

MirBase accessionNone
Sequence
0- GAGAGAAGGCGUGGGAAGGAGC -22
Get sequence
Mature sequence

Aca-Mir-5417_3p

MirBase accessionMIMAT0022037
Sequence
34- UCAUCCCAGCCCCUUUUCUCCC -56
Get sequence