MirGeneDB

MirGeneDB ID

Aca-Mir-5396-P2

Family name MIR-5396 (all species)
Seed CACACAA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-5396b
Paralogues Aca-Mir-5396-P1 
Orthologues
Node of Origin (locus) A. carolinensis
Node of Origin (family) A. carolinensis
Genome context
(anoCar2)
1: 213792664-213792723 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGUUGCAUCUAUGAGCCCAGAAUGGGGCAUCCACACAACCAGCAAGAAGGAAAUAAGAUUAAUCCCUUUCUUCUUGCUGUUUGUGCAGGUGCCUCAUCCUGACAUCAACCAAAGUGACUG
Get precursor sequence
Structure
        10          20        30        40        50         
AGUUGCAUCUAUGAGCC--|  A          CA     C             AUAAGA 
                   CAG AUGGGGCAUC  CACAA CAGCAAGAAGGAA      U
                   GUC UACUCCGUGG  GUGUU GUCGUUCUUCUUU      U
GUCAGUGAAACCAACUACA^  C          AC     U             CCCUAA 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-5396-P2_5p

MirBase accessionMIMAT0037580
Sequence
0- CCACACAACCAGCAAGAAGGAA -22
Get sequence
Star sequence

Aca-Mir-5396-P2_3p*

MirBase accessionMIMAT0037581
Sequence
38- UCUUCUUGCUGUUUGUGCAGGU -60
Get sequence