MirGeneDB

MirGeneDB ID

Aca-Mir-5396-P1

Family name MIR-5396 (all species)
Seed CGCACAA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-5396a
Paralogues Aca-Mir-5396-P2 
Orthologues
Node of Origin (locus) A. carolinensis
Node of Origin (family) A. carolinensis
Genome context
(anoCar2)
1: 69318558-69318617 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GUCUGUAAUGACAGAAUGAGGUGAGAGUGUCCGCACAACCAGCAAGAAGAUGGGAAGAUCUAGCCACUCCUUCUUGUUGGUCAUGUUGGCAUACAGUUUAAAUCUCAGAUGCAAUCAGCA
Get precursor sequence
Structure
        10            20        30        40        50         
GUCUGUAAUGACAGAAU----|  G  AGA     C   CA            AUGGGAAGA 
                     GAG UG   GUGUC GCA  ACCAGCAAGAAG         U
                     UUU AC   UACGG UGU  UGGUUGUUCUUC         C
ACGACUAACGUAGACUCUAAA^  G  A--     U   AC            CUCACCGAU 
.       110       100          90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-5396-P1_5p

MirBase accessionMIMAT0022003
Sequence
0- CCGCACAACCAGCAAGAAGAU -21
Get sequence
Star sequence

Aca-Mir-5396-P1_3p* (predicted)

MirBase accessionNone
Sequence
39- CUUCUUGUUGGUCAUGUUGGC -60
Get sequence