MirGeneDB

Gene name

Tca-Mir-971

Family name MIR-971 (all species)
MiRBase ID tca-mir-971b
Paralogues
Orthologues Dme-Mir-971 
Node of Origin (gene) Pterygota
Node of Origin (family) Pterygota
Genome context
(Tcas5.2)
LG4: 238976-239037 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
ACCACCGAGCUUUGAGUGUGUAUAGUCGGGUCACUCUAAGUUUGAACACCAAGCUACAUUUAGCUCGUUUGGUGUUCUACCUUACAGUGAGCGGACUGUACACCAAAUCAUCACUUCGCAAG
Get precursor sequence
Structure
        10          20        30        40        50        60
ACCACCGAGCUUUGAGU--|         GGG     C    UUU           UACAU 
                   GUGUAUAGUC   UCACU UAAG   GAACACCAAGC     U
                   CACAUGUCAG   AGUGA AUUC   CUUGUGGUUUG     U
GAACGCUUCACUACUAAAC^         GCG     C    CAU           CUCGA 
120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Ad Ea Em Em Em Em Em Oo
Mature sequence

Tca-Mir-971_5p

MirBase accessionMIMAT0045561
Sequence
0- UCACUCUAAGUUUGAACACCAAGC -24
Get sequence
Seed sequenceCACUCUA
Co-mature sequence

Tca-Mir-971_3p

MirBase accessionMIMAT0045562
Sequence
38- UUGGUGUUCUACCUUACAGUGAGC -62
Get sequence
Seed sequenceUGGUGUU