MirGeneDB

Gene name

Dme-Mir-971

Family name MIR-971 (all species)
MiRBase ID dme-mir-971
Paralogues
Orthologues Aae-Mir-971  Bge-Mir-971-v1  Bge-Mir-971-v2  Dan-Mir-971  Dmo-Mir-971  Hme-Mir-971  Tca-Mir-971 
Node of Origin (gene) Pterygota
Node of Origin (family) Pterygota
Genome context
(dm6)
chrX: 13062091-13062152 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGUGAGAGAAUUCCGUGGCUGGCAUCGCUCGCUGUAAAUUGUAAUCAUCAAAGCGUUUUCUCAGAGCCGCUUGGUGUUACUUCUUACAGUGAGUGUGCCAGUCCGUACACAGAAAGAAAACC
Get precursor sequence
Structure
        10           20        30        40        50        60 
UGUGAGAGAAUUCCGUG---|      U            AUU    U      A  GUUUUC 
                    GCUGGCA CGCUCGCUGUAA   GUAA CAUCAA GC      U
                    UGACCGU GUGAGUGACAUU   CAUU GUGGUU CG      C
CCAAAAGAAAGACACAUGCC^      -            CUU    -      -  CCGAGA 
120       110       100         90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Bo He L3 Fe Fe La Wh
Star sequence

Dme-Mir-971_5p*

MirBase accessionMIMAT0020868
Sequence
0- GCUGUAAAUUGUAAUCAUCAAAGC -24
Get sequence
Mature sequence

Dme-Mir-971_3p

MirBase accessionMIMAT0005487
Sequence
40- UUGGUGUUACUUCUUACAGUGA -62
Get sequence
Seed sequenceUGGUGUU
Validated targets microrna.org: MIMAT0005487
TargetScanFly: dme-miR-971