MirGeneDB

Gene name

Bge-Mir-971-v1

Family name MIR-971 (all species)
MiRBase ID
Paralogues Bge-Mir-971-v2 
Orthologues Aae-Mir-971  Dan-Mir-971  Dme-Mir-971  Dmo-Mir-971  Hme-Mir-971  Tca-Mir-971 
Node of Origin (gene) B. germanica
Node of Origin (family) Pterygota
Genome context
(Bger_2.0)
KZ615707.1: 119208-119269 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGACUGCUGUGGAUAUCUCUGAGGUCCGUCCACUCUAAGCUCGAACACCAAGCCUGGAACCUGUACCGUUUGGUGUUCUACCUUACAGUGAGCGGACUUCAGUAGCAAGCAUCACGAUCAAG
Get precursor sequence
Structure
        10          20        30        40        50        60
AGACUGCUGUGGAUAUCU--|         UC    C    CUC           CUGGAA 
                    CUGAGGUCCG  CACU UAAG   GAACACCAAGC      C
                    GACUUCAGGC  GUGA AUUC   CUUGUGGUUUG      C
GAACUAGCACUACGAACGAU^         GA    C    CAU           CCAUGU 
120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ad Ny Ny Ny Ny Ny Ny Ny Ny Ov Co Co Em Em Em Em Em Em Em Em Em Em No No
Mature sequence

Bge-Mir-971-v1_5p

MirBase accessionNone
Sequence
0- CACUCUAAGCUCGAACACCAAGC -23
Get sequence
Seed sequenceACUCUAA
Star sequence

Bge-Mir-971-v1_3p*

MirBase accessionNone
Sequence
39- UUGGUGUUCUACCUUACAGUGAG -62
Get sequence