MirGeneDB

Gene name

Dme-Mir-216-P1

Family name MIR-216 (all species)
MiRBase ID dme-mir-304
Paralogues Dme-Mir-216-P2 
Orthologues Aca-Mir-216-P1a  Aca-Mir-216-P1b  Ami-Mir-216-P1a  Ami-Mir-216-P1b  Asu-Mir-216-P1  Bfl-Mir-216-P1  Bta-Mir-216-P1a  Bta-Mir-216-P1b  Cel-Mir-216-P1  Cfa-Mir-216-P1a  Cfa-Mir-216-P1b  Cgi-Mir-216-P1  Cli-Mir-216-P1a  Cli-Mir-216-P1b  Cpi-Mir-216-P1a  Cpi-Mir-216-P1b  Cpo-Mir-216-P1a  Cpo-Mir-216-P1b  Cte-Mir-216-P1c  Cte-Mir-216-P1d  Dno-Mir-216-P1a  Dno-Mir-216-P1b  Dpu-Mir-216-P1  Dre-Mir-216-P1a  Dre-Mir-216-P1b  Efe-Mir-216-P1  Ete-Mir-216-P1a  Ete-Mir-216-P1b  Gga-Mir-216-P1a  Gga-Mir-216-P1b  Hsa-Mir-216-P1a  Hsa-Mir-216-P1b  Isc-Mir-216-P1  Lgi-Mir-216-P1  Mdo-Mir-216-P1a  Mdo-Mir-216-P1b  Mml-Mir-216-P1a  Mml-Mir-216-P1b  Mmu-Mir-216-P1a  Mmu-Mir-216-P1b  Ocu-Mir-216-P1a  Ocu-Mir-216-P1b  Rno-Mir-216-P1a  Rno-Mir-216-P1b  Sha-Mir-216-P1a  Sha-Mir-216-P1b  Tca-Mir-216-P1  Xtr-Mir-216-P1a 
Node of Origin (gene) Bilateria
Node of Origin (family) Bilateria
Genome context
(dm6)
chrX: 15508970-15509037 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-216-P1)
Mir-216-P2 chrX: 15507976-15508044 [+] UCSC Ensembl
Mir-12 chrX: 15509479-15509542 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACCAGUACCAAUUGUAUCUGCAGCAUUGAAUAAUCUCAAUUUGUAAAUGUGAGCGGUUUAAGCCAUUUGACGCACUCACUUUGCAAUUGGAGAUUGCUCGAGACUGCGGCAUAUGCCACAUUAUUAUG
Get precursor sequence
Structure
        10          20        30        40        50        60    
ACCAGUACCAAUUGUAU--|     CA    A       AAU       U     CGGUUUAAGC 
                   CUGCAG  UUGA UAAUCUC   UUGUAAA GUGAG          \
                   GGCGUC  AGCU GUUAGAG   AACGUUU CACUC          C
GUAUUAUUACACCGUAUAC^     AG    C       GUU       -     ACGCAGUUUA 
      120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo He L3 Fe Fe La Wh
Mature sequence

Dme-Mir-216-P1_5p

MirBase accessionMIMAT0000390
Sequence
0- UAAUCUCAAUUUGUAAAUGUGAG -23
Get sequence
Seed sequenceAAUCUCA
Validated targets microrna.org: MIMAT0000390
TargetScanFly: dme-miR-304
Star sequence

Dme-Mir-216-P1_3p*

MirBase accessionMIMAT0020826
Sequence
46- CACUUUGCAAUUGGAGAUUGCU -68
Get sequence