MirGeneDB

MirGeneDB ID

Asu-Mir-216-P1

Family name MIR-216 (all species)
Seed AAUCUCG
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-5362
Paralogues Asu-Mir-216-P2 
Orthologues Aae-Mir-216-P1  Aca-Mir-216-P1a  Aca-Mir-216-P1b  Ami-Mir-216-P1a  Ami-Mir-216-P1b  Bfl-Mir-216-P1  Bge-Mir-216-P1  Bta-Mir-216-P1a  Bta-Mir-216-P1b  Cbr-Mir-216-P1  Cel-Mir-216-P1  Cfa-Mir-216-P1a  Cfa-Mir-216-P1b  Cgi-Mir-216-P1  Cli-Mir-216-P1a  Cli-Mir-216-P1b  Cpi-Mir-216-P1a  Cpi-Mir-216-P1b  Cpo-Mir-216-P1a  Cpo-Mir-216-P1b  Cte-Mir-216-P1c  Cte-Mir-216-P1d  Dan-Mir-216-P1  Dme-Mir-216-P1  Dmo-Mir-216-P1  Dno-Mir-216-P1a  Dno-Mir-216-P1b  Dpu-Mir-216-P1  Dre-Mir-216-P1a  Dre-Mir-216-P1b  Efe-Mir-216-P1  Ete-Mir-216-P1a  Ete-Mir-216-P1b  Gga-Mir-216-P1a  Gga-Mir-216-P1b  Hme-Mir-216-P1  Hsa-Mir-216-P1a  Hsa-Mir-216-P1b  Isc-Mir-216-P1  Lan-Mir-216-P1e  Lan-Mir-216-P1f  Lgi-Mir-216-P1  Mdo-Mir-216-P1a  Mdo-Mir-216-P1b  Mml-Mir-216-P1a  Mml-Mir-216-P1b  Mmu-Mir-216-P1a  Mmu-Mir-216-P1b  Oan-Mir-216-P1a  Oan-Mir-216-P1b  Ocu-Mir-216-P1a  Ocu-Mir-216-P1b  Rno-Mir-216-P1a  Rno-Mir-216-P1b  Sha-Mir-216-P1a  Sha-Mir-216-P1b  Sto-Mir-216-P1a  Sto-Mir-216-P1b  Tca-Mir-216-P1  Tgu-Mir-216-P1a  Tgu-Mir-216-P1b  Xtr-Mir-216-P1a 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold36: 852366-852422 [+]
Clustered MiRNAs
(< 10kb from Mir-216-P1)
Mir-216-P2 Scaffold36: 852176-852234 [+]
Mir-216-P1 Scaffold36: 852366-852422 [+]
Precursor
(pre-Mir +30nt flank)
UCGCCAUUUUCUUCGAUGAGAUGUGCAGUUAAAUCUCGUCCGGUAGUAUAUGCGAGUUGAAAAGCAUUGCAACCGGUGGAGAUUCCACUGACUUCUCUAUUUUCAAAGCAUGAAUCC
Get precursor sequence
Structure
        10           20        30        40        50        
UCGCCAUUUUCUUCGAU---|   U  G    UA      GU     A   U    GAGU 
                    GAGA GU CAGU  AAUCUC  CCGGU GUA AUGC    U
                    CUCU CA GUCA  UUAGAG  GGCCA CGU UACG    G
CCUAAGUACGAAACUUUUAU^   U  -    CC      GU     A   -    AAAA 
     110       100         90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Mature sequence

Asu-Mir-216-P1_5p

MirBase accessionMIMAT0021586
Sequence
0- AAAUCUCGUCCGGUAGUAUAUGC -23
Get sequence
Star sequence

Asu-Mir-216-P1_3p*

MirBase accessionMIMAT0021587
Sequence
35- AUUGCAACCGGUGGAGAUUCCA -57
Get sequence