MirGeneDB

Gene name

Tca-Mir-216-P1

Family name MIR-216 (all species)
MiRBase ID tca-mir-3477
Paralogues Tca-Mir-216-P2 
Orthologues Aca-Mir-216-P1a  Aca-Mir-216-P1b  Ami-Mir-216-P1a  Ami-Mir-216-P1b  Asu-Mir-216-P1  Bfl-Mir-216-P1  Bta-Mir-216-P1a  Bta-Mir-216-P1b  Cel-Mir-216-P1  Cfa-Mir-216-P1a  Cfa-Mir-216-P1b  Cgi-Mir-216-P1  Cli-Mir-216-P1a  Cli-Mir-216-P1b  Cpi-Mir-216-P1a  Cpi-Mir-216-P1b  Cpo-Mir-216-P1a  Cpo-Mir-216-P1b  Cte-Mir-216-P1c  Cte-Mir-216-P1d  Dme-Mir-216-P1  Dno-Mir-216-P1a  Dno-Mir-216-P1b  Dpu-Mir-216-P1  Dre-Mir-216-P1a  Dre-Mir-216-P1b  Efe-Mir-216-P1  Ete-Mir-216-P1a  Ete-Mir-216-P1b  Gga-Mir-216-P1a  Gga-Mir-216-P1b  Hsa-Mir-216-P1a  Hsa-Mir-216-P1b  Isc-Mir-216-P1  Lgi-Mir-216-P1  Mdo-Mir-216-P1a  Mdo-Mir-216-P1b  Mml-Mir-216-P1a  Mml-Mir-216-P1b  Mmu-Mir-216-P1a  Mmu-Mir-216-P1b  Ocu-Mir-216-P1a  Ocu-Mir-216-P1b  Rno-Mir-216-P1a  Rno-Mir-216-P1b  Sha-Mir-216-P1a  Sha-Mir-216-P1b  Xtr-Mir-216-P1a 
Node of Origin (gene) Bilateria
Node of Origin (family) Bilateria
Genome context
(Tcas5.2)
LG3: 21686284-21686342 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-216-P1)
Mir-12 LG3: 21686059-21686118 [-] Ensembl
Mir-216-P2 LG3: 21690387-21690444 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
UAAUUGUUUGCACGCUUGACUGCGUUUCGUUAAUCUCAUUUGGUAACUGUGAGGUUUGUUUAUUCCUCAGACUACUGAAUGGGAUCGACAAAAUGUGGUUUUGUUUUCACCAUUUUUAU
Get precursor sequence
Structure
        10          20        30        40         50         
UAAUUGUUUGCACGCUU--   UG     C  UA        UG   A-   U-| GGUUU 
                   GAC  CGUUU GU  AUCUCAUU  GUA  CUG  GA     \
                   UUG  GUAAA CA  UAGGGUAA  CAU  GAC  CU     G
UAUUUUUACCACUUUUGUU   GU     A  GC        GU   CA   UC^ UAUUU 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Ad Ea Em Em Em Em Em Oo
Mature sequence

Tca-Mir-216-P1_5p

MirBase accessionMIMAT0018736
Sequence
0- UAAUCUCAUUUGGUAACUGUGA -22
Get sequence
Seed sequenceAAUCUCA
Co-mature sequence

Tca-Mir-216-P1_3p

MirBase accessionMIMAT0018737
Sequence
36- UCAGACUACUGAAUGGGAUCGAC -59
Get sequence
Seed sequenceCAGACUA