MirGeneDB

MirGeneDB ID

Spu-Mir-2009

Family name MIR-2009 (all species)
Seed GAGUUGU
Species Purple sea urchin (Strongylocentrotus purpuratus)
MiRBase ID spu-mir-2009
Paralogues
Orthologues Pfl-Mir-2009  Pmi-Mir-2009 
Node of Origin (locus) Ambulacraria
Node of Origin (family) Ambulacraria
Genome context
(Spur_3.1)
Scaffold3006: 37992-38052 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AGAUUAUACUUCAAAUCCUCAGUAAUCUUUGGUUUUUGUGGAACAGCUCCUGUGAAUUAUAUAAGACCAUGAGUUGUCCCACAAAGAACACAGAUCGCUGUGAAUCAUCACUUCAAACUUC
Get precursor sequence
Structure
        10          20        30        40        50          
AGAUUAUACUUCAAAUCCU--|  UA    U  G         A       C  UGAAUUA 
                     CAG  AUCU UG UUUUUGUGG ACAGCUC UG       \
                     GUC  UAGA AC AGAAACACC UGUUGAG AC       U
CUUCAAACUUCACUACUAAGU^  GC    C  A         C       U  CAGAAUA 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
32 Bl Eg Ga Ov Pl To To
Star sequence

Spu-Mir-2009_5p*

MirBase accessionNone
Sequence
0- GGUUUUUGUGGAACAGCUCCUG -22
Get sequence
Mature sequence

Spu-Mir-2009_3p

MirBase accessionMIMAT0009750
Sequence
39- UGAGUUGUCCCACAAAGAACAC -61
Get sequence