MirGeneDB

MirGeneDB ID

Spu-Mir-2005

Family name MIR-2005 (all species)
Seed GUCCAAU
Species Purple sea urchin (Strongylocentrotus purpuratus)
MiRBase ID spu-mir-2005
Paralogues
Orthologues Pmi-Mir-2005 
Node of Origin (locus) Eleutherozoa
Node of Origin (family) Eleutherozoa
Genome context
(Spur_3.1)
Scaffold1753: 115422-115485 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GCCUCGCCUCUACUUGUCAAUCUUUGGUGCAGUCCAAUAGGGAGGGCAUUGCAGGUGAUAUUUGAAAGCCCUGCAGUGGCUCCUAUUGGUCAUUACCAGAUGAUUGACAUCACAUCCAGAGAUC
Get precursor sequence
Structure
        10         20         30        40        50        60  
GCCUCGCCUCUACUUGU-     -|      CAGU        GA  G        GUGAUAU 
                  CAAUC UUUGGUG    CCAAUAGG  GG CAUUGCAG       U
                  GUUAG AGACCAU    GGUUAUCC  UC GUGACGUC       U
CUAGAGACCUACACUACA     U^      UACU        --  G        CCGAAAG 
  120       110       100        90          80        70
Deep sequencing
Go to detailed chart
CommentAlthough there is no star recorded for Mir-2005 expression of the 5p arm is deeply conserved across eleutherozoan echinoderms.
3' NTU Unknown
MotifsUGUG in loop
Tissue expression
 +
32 Bl Eg Ga Ov Pl To To
Mature sequence

Spu-Mir-2005_5p

MirBase accessionMIMAT0009746
Sequence
0- AGUCCAAUAGGGAGGGCAUUGCAG -24
Get sequence
Star sequence

Spu-Mir-2005_3p* (predicted)

MirBase accessionNone
Sequence
42- GCAGUGGCUCCUAUUGGUCAUU -64
Get sequence