MirGeneDB

MirGeneDB ID

Spu-Mir-2004

Family name MIR-2004 (all species)
Seed CACACAC
Species Purple sea urchin (Strongylocentrotus purpuratus)
MiRBase ID spu-mir-2004
Paralogues
Orthologues Pmi-Mir-2004 
Node of Origin (locus) Eleutherozoa
Node of Origin (family) Eleutherozoa
Genome context
(Spur_3.1)
Scaffold912: 124828-124892 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
UUAGAUAGAGAAGAGAGGCUACUUGCGGACCUUUCUGUGGCUGUCGUGUUAAGUGUGAUUCUAUGAAGACACUUCACACACAACCACAGGAAGUUUUGCACGGUAGCCAUGACAACGCAUCCGGA
Get precursor sequence
Structure
        10         20         30        40        50        60  
UUAGAUAGAGAAGAGAG-      -|     C          C   C    U   UGUGAUUC 
                  GCUACU UGCGGA CUUUCUGUGG UGU GUGU AAG        U
                  CGAUGG ACGUUU GAAGGACACC ACA CACA UUC        A
AGGCCUACGCAACAGUAC      C^     U          A   -    C   ACAGAAGU 
   120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
32 Bl Eg Ga Ov Pl To To
Star sequence

Spu-Mir-2004_5p* (predicted)

MirBase accessionNone
Sequence
0- CUUUCUGUGGCUGUCGUGUUAAG -23
Get sequence
Mature sequence

Spu-Mir-2004_3p

MirBase accessionMIMAT0009745
Sequence
43- UCACACACAACCACAGGAAGUU -65
Get sequence