MirGeneDB

MirGeneDB ID

Mmu-Mir-330-v2

Family name MIR-330 (all species)
Seed CAAAGCA
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-330
Paralogues Mmu-Mir-330-v1 
Orthologues Bta-Mir-330-v2  Cfa-Mir-330-v2  Cpo-Mir-330-v2  Dno-Mir-330-v2  Ete-Mir-330-v2  Hsa-Mir-330-v2  Mml-Mir-330-v2  Ocu-Mir-330-v2  Rno-Mir-330-v2 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(mm10)
chr7: 19181486-19181549 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-330-v2)
Mir-330-v1 chr7: 19181486-19181549 [+] UCSC Ensembl
Mir-330-v2 chr7: 19181486-19181549 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GUGCUGUGUGACCCUUUGGCGAUCUCUGCCUCUCUGGGCCUGUGUCUUAGGCUCUUCAAGAUCCAACGAGCAAAGCACAGGGCCUGCAGAGAGGUAGCGCUCUGCUCCUUACUCGCCUGAUUAU
Get precursor sequence
Structure
        10              20        30          40         50        60 
GUGCUGUGUGACCCUUU------|   AUCU           --    -    U   AG    UUCAAG 
                       GGCG    CUGCCUCUCUG  GGCC UGUG CUU  GCUC      \
                       UCGC    GAUGGAGAGAC  CCGG ACAC GAA  CGAG      A
UAUUAGUCCGCUCAUUCCUCGUC^   ----           GU    G    -   A-    CAACCU 
  120       110       100            90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-330-v2_5p*

MirBase accessionMIMAT0004642
Sequence
0- UCUCUGGGCCUGUGUCUUAGGCUC -24
Get sequence
Validated targets microrna.org: MIMAT0004642
TargetScanVert: mmu-miR-330-5p
miRDB: MIMAT0004642
Mature sequence

Mmu-Mir-330-v2_3p

MirBase accessionMIMAT0000569
Sequence
39- GCAAAGCACAGGGCCUGCAGAGAGG -64
Get sequence
Validated targets microrna.org: MIMAT0000569
miRDB: MIMAT0000569