MirGeneDB

MirGeneDB ID

Lgi-Novel-1

Family name LGI-NOVEL-1 (all species)
Seed CAAACAU
Species Owl limpet (Lottia gigantea)
MiRBase ID
Paralogues
Orthologues
Node of Origin (locus) L. gigantea
Node of Origin (family) L. gigantea
Genome context
(Lotgi1)
LOTGIsca_115: 803487-803546 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
GUGAAGACACAGGAACCAAUAUUGAGGGAGCUUGCCAAUGUCUUGUUUUCUGAUUAAAAUUUAACUCACAAACAUCACAUUUGUAAGGUUUCCACUUUAUUACCUACAACAUCAUUUAGA
Get precursor sequence
Structure
        10        20          30         40        50         
GUGAAGACACAGGAACCAAUAUUGA--     -|    C     CU     UC   UUAAA 
                           GGGAG CUUGC AAUGU  UGUUU  UGA     A
                           CCUUU GAAUG UUACA  ACAAA  ACU     U
AGAUUUACUACAACAUCCAUUAUUUCA     G^    U     CU     C-   CAAUU 
.       110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Lgi-Novel-1_5p*

MirBase accessionNone
Sequence
0- CUUGCCAAUGUCUUGUUUUCUGA -23
Get sequence
Mature sequence

Lgi-Novel-1_3p

MirBase accessionNone
Sequence
37- ACAAACAUCACAUUUGUAAGGUU -60
Get sequence