MirGeneDB

MirGeneDB ID

Hsa-Mir-4424

Family name MIR-4424 (all species)
Seed UCCAUUU
Species Human (Homo sapiens)
MiRBase ID hsa-mir-4424
Paralogues
Orthologues
Node of Origin (locus) H. sapiens
Node of Origin (family) H. sapiens
Genome context
(hg38)
chr1: 178677763-178677822 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAAAUUGGACCAUUAUCUUACAUCACACACAGAGUUAACUCAAAAUGGACUAAUUUUUCCACUAGUUAGUCCAUUUCAAGUUAACUCUGUGUGUGAUGUAGUCUAGAAACUCUGGAGGCU
Get precursor sequence
Structure
        10          20        30        40        50         
GAAAUUGGACCAUUAUC--|                      CA          AUUUUU 
                   UUACAUCACACACAGAGUUAACU  AAAUGGACUA      C
                   GAUGUAGUGUGUGUCUCAAUUGA  UUUACCUGAU      C
UCGGAGGUCUCAAAGAUCU^                      AC          UGAUCA 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Star sequence

Hsa-Mir-4424_5p*

MirBase accessionMIMAT0018939
Sequence
0- AGAGUUAACUCAAAAUGGACUA -22
Get sequence
Validated targets TargetScanVert: hsa-miR-4424
TargetMiner: hsa-miR-4424
miRDB: MIMAT0018939
Mature sequence

Hsa-Mir-4424_3p

MirBase accessionNone
Sequence
38- GUCCAUUUCAAGUUAACUCUGU -60
Get sequence