MirGeneDB

MirGeneDB ID

Hsa-Mir-3145

Family name MIR-3145 (all species)
Seed GAUAUUU
Species Human (Homo sapiens)
MiRBase ID hsa-mir-3145
Paralogues
Orthologues Mml-Mir-3145 
Node of Origin (locus) Catarrhini
Node of Origin (family) Catarrhini
Genome context
(hg38)
chr6: 138435222-138435283 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAAAAAAAAUGUAUUUGUUUAUAUGAGUUCAACUCCAAACACUCAAAACUCAUUGUUGAAUGGAAUGAGAUAUUUUGAGUGUUUGGAAUUGAACUCGUAUACACUGAUACACCGAUACCAGU
Get precursor sequence
Structure
        10          20        30        40           50         
GAAAAAAAAUGUAUUUGUU--             C               ---|   UUGUUG 
                     UAUAUGAGUUCAA UCCAAACACUCAAAA   CUCA      \
                     AUAUGCUCAAGUU AGGUUUGUGAGUUUU   GAGU      A
UGACCAUAGCCACAUAGUCAC             A               AUA^   AAGGUA 
120       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
CommentBecause of a secondary structural difference between the primates the major form of the mature 3p arm is shifted +3 relative to macaque.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Star sequence

Hsa-Mir-3145_5p*

MirBase accessionMIMAT0019205
Sequence
0- AACUCCAAACACUCAAAACUCA -22
Get sequence
Validated targets TargetScanVert: hsa-miR-3145-5p
TargetMiner: hsa-miR-3145-5p
miRDB: MIMAT0019205
Mature sequence

Hsa-Mir-3145_3p

MirBase accessionMIMAT0015016
Sequence
37- AGAUAUUUUGAGUGUUUGGAAUUGA -62
Get sequence
Validated targets microrna.org: MIMAT0015016
TargetScanVert: hsa-miR-3145-3p
TargetMiner: hsa-miR-3145-3p
miRDB: MIMAT0015016