MirGeneDB

MirGeneDB ID

Hsa-Mir-197

Family name MIR-197 (all species)
Seed UCACCAC
Species Human (Homo sapiens)
MiRBase ID hsa-mir-197
Paralogues
Orthologues Bta-Mir-197  Cfa-Mir-197  Cpo-Mir-197  Dno-Mir-197  Mml-Mir-197  Ocu-Mir-197 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(hg38)
chr1: 109598901-109598961 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUUCUGGAAUCUGUGCUCUGGGGGCUGUGCCGGGUAGAGAGGGCAGUGGGAGGUAAGAGCUCUUCACCCUUCACCACCUUCUCCACCCAGCAUGGCCGGCACACUUUGGUCUACGGCACAU
Get precursor sequence
Structure
        10        20          30        40        50          
CUUCUGGAAUCUGUGCUCUGGG--|       C    A       CA    GA  UAAGAG 
                        GGCUGUGC GGGU GAGAGGG  GUGG  GG      \
                        CCGGUACG CCCA CUCUUCC  CACU  CC      C
UACACGGCAUCUGGUUUCACACGG^       A    C       AC    UC  ACUUCU 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Star sequence

Hsa-Mir-197_5p*

MirBase accessionMIMAT0022691
Sequence
0- CGGGUAGAGAGGGCAGUGGGAGG -23
Get sequence
Validated targets TargetScanVert: hsa-miR-197-5p
TargetMiner: hsa-miR-197-5p
miRDB: MIMAT0022691
Mature sequence

Hsa-Mir-197_3p

MirBase accessionMIMAT0000227
Sequence
39- UUCACCACCUUCUCCACCCAGC -61
Get sequence
Validated targets microrna.org: MIMAT0000227
TargetScanVert: hsa-miR-197-3p
TargetMiner: hsa-miR-197-3p
miRDB: MIMAT0000227