
MirGeneDB ID


Family name DAN-NOVEL-12 (all species)
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues Dan-Novel-12-P1 
Node of Origin (locus) D. ananassae
Node of Origin (family) D. ananassae
Genome context
scaffold_13045: 592980-593037 [+] Ensembl
(pre-Mir +30nt flank)
Get precursor sequence
        10          20        30        40        50        
AAAAUACGUGUGCCCUUGC--|    C             G     A       CUUGA 
GACUACAAGAACCUGCUUUUA^    A             G     G       GUCUA 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
Mature sequence


MirBase accessionNone
Get sequence
Co-mature sequence


MirBase accessionNone
Get sequence