MirGeneDB

MirGeneDB ID

Dan-Mir-1003

Family name MIR-1003 (all species)
Seed CUCACAU
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues
Orthologues Dme-Mir-1003-P1  Dme-Mir-1003-P2  Dmo-Mir-1003 
Node of Origin (locus) Drosophila
Node of Origin (family) Drosophila
Genome context
(Dana_caf1)
scaffold_13340: 4690341-4690403 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
GCGCGAACUGGCGCUCAAGCUACGCCGAAGGUGAGUAUAGUGGAUGUGGGUGGCUCUUAUUUGGCCGGUCCUCUCACAUCUCCAUAUUCACAGGCGUCGAGAGCUGCGCCACAAGUAUGGUAC
Get precursor sequence
Structure
        10         20            30        40        50        60 
GCGCGAACUGGCGCUCA-    ----|    GAAG        AGU         U  CUCUUAU 
                  AGCU    ACGCC    GUGAGUAU   GGAUGUGGG GG       U
                  UCGA    UGCGG    CACUUAUA   UCUACACUC CC       U
CAUGGUAUGAACACCGCG    GAGC^    A---        CC-         U  UGGCCGG 
 120       110       100           90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Star sequence

Dan-Mir-1003_5p*

MirBase accessionNone
Sequence
0- GUGAGUAUAGUGGAUGUGGGUGG -23
Get sequence
Mature sequence

Dan-Mir-1003_3p

MirBase accessionNone
Sequence
41- UCUCACAUCUCCAUAUUCACAG -63
Get sequence